ID: 1202712822_1202712829

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1202712822 1202712829
Species Human (GRCh38) Human (GRCh38)
Location 1_KI270714v1_random:27020-27042 1_KI270714v1_random:27042-27064
Sequence CCCCGCCCGACCTGGCTCACGTT TGCAGGAAACGCGACACCGCAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 18, 4: 171} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!