ID: 1202715712_1202715717

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1202715712 1202715717
Species Human (GRCh38) Human (GRCh38)
Location 1_KI270714v1_random:41321-41343 1_KI270714v1_random:41340-41362
Sequence CCCTGGGATGCCCCAGCAGCGTG CGTGCTGCTTACAGAGCCCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!