ID: 1202791090_1202791095

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1202791090 1202791095
Species Human (GRCh38) Human (GRCh38)
Location 9_KI270719v1_random:90652-90674 9_KI270719v1_random:90675-90697
Sequence CCCAACTCGGACAGAAGGCCCAT GAGTTGAATTTGAAGTTTGTGGG
Strand - +
Off-target summary {0: 6, 1: 22, 2: 13, 3: 106, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!