ID: 1202800411_1202800426

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1202800411 1202800426
Species Human (GRCh38) Human (GRCh38)
Location 9_KI270719v1_random:170323-170345 9_KI270719v1_random:170353-170375
Sequence CCGAGTGCCCATACCAACGGCCC CCTCAGGTGGAGGACTGGGCGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!