ID: 1202800417_1202800431

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202800417 1202800431
Species Human (GRCh38) Human (GRCh38)
Location 9_KI270719v1_random:170343-170365 9_KI270719v1_random:170369-170391
Sequence CCCCGATCTCCCTCAGGTGGAGG GGGCGGGAGGCACAGCCTGGGGG
Strand - +
Off-target summary No data {0: 4, 1: 3, 2: 18, 3: 74, 4: 513}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!