ID: 1202805450_1202805462

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1202805450 1202805462
Species Human (GRCh38) Human (GRCh38)
Location 11_KI270721v1_random:3568-3590 11_KI270721v1_random:3612-3634
Sequence CCGGTGCTGCGCGTGGCCCTGAC AGGAAGAAAAGGTCTGAGTGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!