ID: 1202807669_1202807682 |
View in Genome Browser |
Spacer: -1 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1202807669 | 1202807682 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 11_KI270721v1_random:13864-13886 | 11_KI270721v1_random:13886-13908 |
| Sequence | CCCCCATGTCTCCCACAGGCCTC | CCCTGCCAGGGAGGAGAAAGGGG |
| Strand | - | + |
| Off-target summary | No data | {0: 2, 1: 1, 2: 13, 3: 69, 4: 581} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||