ID: 1202828694_1202828698

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1202828694 1202828698
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000009v2_random:3579-3601 14_GL000009v2_random:3610-3632
Sequence CCATGGATATAGGAACAGTATCC GTGTACACCCCCTGCCATATTGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 2, 3: 16, 4: 99} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!