ID: 1202858185_1202858196

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1202858185 1202858196
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:64239-64261 14_GL000225v1_random:64275-64297
Sequence CCTGGGGCAGGTTGGGAGATACC GCCTTGCTGGGCTGGAGCACGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!