ID: 1202859193_1202859202

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1202859193 1202859202
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:71376-71398 14_GL000225v1_random:71420-71442
Sequence CCGGAGGCCGGCAGAGACAGCTA GGAGCTCCATGGTGGCAGCTGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 13, 3: 38, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!