ID: 1202859506_1202859524

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1202859506 1202859524
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:72587-72609 14_GL000225v1_random:72637-72659
Sequence CCGCCCTCGCTCCCTAGCTCACG GCGCAGGGCACATGGGTTGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 405} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!