ID: 1202860678_1202860687

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1202860678 1202860687
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:79394-79416 14_GL000225v1_random:79433-79455
Sequence CCTGGCTGGGCTGGAGCTCGGGG GGCCCACGAAAGCCCCCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 47, 3: 234, 4: 4798} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!