ID: 1202872643_1202872647

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1202872643 1202872647
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000225v1_random:177950-177972 14_GL000225v1_random:177963-177985
Sequence CCTCGCACCAGGGGCTCCCTCCG GCTCCCTCCGAGCCCGGGCATGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 1, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!