ID: 1202889262_1202889267

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1202889262 1202889267
Species Human (GRCh38) Human (GRCh38)
Location 14_KI270722v1_random:140400-140422 14_KI270722v1_random:140450-140472
Sequence CCTCTCATGTTGGAATGGACAAA TGCACTAATCCCAATCAGGATGG
Strand - +
Off-target summary {0: 5, 1: 1, 2: 2, 3: 34, 4: 359} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!