ID: 1202900226_1202900232

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202900226 1202900232
Species Human (GRCh38) Human (GRCh38)
Location 14_GL000194v1_random:32230-32252 14_GL000194v1_random:32256-32278
Sequence CCAGCAGAGGAAGACCGGGGTAG GCTCCACCAGGGTGATCCTCAGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 9, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!