ID: 1202919010_1202919016

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1202919010 1202919016
Species Human (GRCh38) Human (GRCh38)
Location 14_KI270723v1_random:13612-13634 14_KI270723v1_random:13638-13660
Sequence CCAGGCCATGCTATATAGAACAA TTCCTGTGGGCAGGCTAAGGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!