ID: 1202920785_1202920792

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1202920785 1202920792
Species Human (GRCh38) Human (GRCh38)
Location 14_KI270723v1_random:29102-29124 14_KI270723v1_random:29127-29149
Sequence CCTCCAAGTTTTCCCATCTGGGC CAGAGAGTAGGGAAGGAAGTCGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 3, 3: 85, 4: 1103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!