ID: 1202921967_1202921976

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1202921967 1202921976
Species Human (GRCh38) Human (GRCh38)
Location 14_KI270723v1_random:35273-35295 14_KI270723v1_random:35312-35334
Sequence CCCACAGGGGGCTTTCATGAGCC CCCCGTGCTCCAGCCCAGCCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!