ID: 1202926208_1202926218

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1202926208 1202926218
Species Human (GRCh38) Human (GRCh38)
Location 14_KI270724v1_random:28400-28422 14_KI270724v1_random:28416-28438
Sequence CCCTCCTTCTCCGCTGGGTCAGC GGTCAGCTCGGGCTCGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 1, 3: 17, 4: 165} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!