ID: 1202993959_1202993963 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1202993959 | 1202993963 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16_KI270728v1_random:38206-38228 | 16_KI270728v1_random:38253-38275 |
| Sequence | CCTCCAGAATGGGAGGAGATATT | CCTAATATCCAGACTCCATAGGG |
| Strand | - | + |
| Off-target summary | {0: 8, 1: 7, 2: 226, 3: 3349, 4: 15598} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||