ID: 1202996082_1202996087

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1202996082 1202996087
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:111753-111775 16_KI270728v1_random:111798-111820
Sequence CCCAGCTCTGTATGTTTATGTCG GTTTATTAGGATGGCCAAAAAGG
Strand - +
Off-target summary No data {0: 9, 1: 1, 2: 0, 3: 11, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!