ID: 1203029260_1203029262

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1203029260 1203029262
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:559421-559443 16_KI270728v1_random:559438-559460
Sequence CCAATGGTGAAGTGAATATCCAA ATCCAAGGATAAAAACTAGAAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 0, 3: 12, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!