ID: 1203029263_1203029264

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203029263 1203029264
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:559440-559462 16_KI270728v1_random:559467-559489
Sequence CCAAGGATAAAAACTAGAAGGAA TATGAGAAATCACTTTGTGATGG
Strand - +
Off-target summary {0: 496, 1: 1004, 2: 1164, 3: 1638, 4: 2328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!