ID: 1203029333_1203029342

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1203029333 1203029342
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:560610-560632 16_KI270728v1_random:560662-560684
Sequence CCAATGGCAAAAAAGTGAGTATC GAGAAACCACTTTGTGATGGGGG
Strand - +
Off-target summary {0: 8, 1: 137, 2: 329, 3: 766, 4: 3537} {0: 3, 1: 8, 2: 88, 3: 524, 4: 2764}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!