ID: 1203029336_1203029339

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203029336 1203029339
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:560632-560654 16_KI270728v1_random:560659-560681
Sequence CCCAGGATAAAAATTAGAAGGAG TCTGAGAAACCACTTTGTGATGG
Strand - +
Off-target summary {0: 3, 1: 47, 2: 636, 3: 1199, 4: 1617} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!