ID: 1203029336_1203029341

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1203029336 1203029341
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:560632-560654 16_KI270728v1_random:560661-560683
Sequence CCCAGGATAAAAATTAGAAGGAG TGAGAAACCACTTTGTGATGGGG
Strand - +
Off-target summary {0: 3, 1: 47, 2: 636, 3: 1199, 4: 1617} {0: 7, 1: 89, 2: 421, 3: 644, 4: 1826}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!