ID: 1203034554_1203034559 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1203034554 | 1203034559 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 16_KI270728v1_random:628447-628469 | 16_KI270728v1_random:628464-628486 |
Sequence | CCCGCCAGCCTACACTGCCAGCC | CCAGCCGCCACCTGACCACACGG |
Strand | - | + |
Off-target summary | {0: 5, 1: 3, 2: 2, 3: 48, 4: 541} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |