ID: 1203078595_1203078602

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1203078595 1203078602
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1135117-1135139 16_KI270728v1_random:1135157-1135179
Sequence CCTCTGGGGCAGGGGGCTGGAGA ACCTGGCCAACCTACTGCTGTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!