ID: 1203089054_1203089062

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1203089054 1203089062
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1201472-1201494 16_KI270728v1_random:1201495-1201517
Sequence CCCGGCTCTAGTGACTTTCCCTG CTGGCCCCACTGAGGTTTTGGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!