ID: 1203124769_1203124775

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1203124769 1203124775
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1563953-1563975 16_KI270728v1_random:1564005-1564027
Sequence CCTGGCCACTTCACTGTCCTCTG CAAGACTCTAGTTAATTTCTTGG
Strand - +
Off-target summary {0: 3, 1: 35, 2: 12, 3: 26, 4: 355} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!