ID: 1203132658_1203132664

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1203132658 1203132664
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1700983-1701005 16_KI270728v1_random:1701013-1701035
Sequence CCCCTAGCTAGAGGTGGGTGTAG AAACATGAACAAATGGAGCTGGG
Strand - +
Off-target summary No data {0: 15, 1: 0, 2: 1, 3: 33, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!