ID: 1203143101_1203143106

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1203143101 1203143106
Species Human (GRCh38) Human (GRCh38)
Location 16_KI270728v1_random:1781795-1781817 16_KI270728v1_random:1781825-1781847
Sequence CCAGATGGGTGTGACTATTGTAG GTGGATCCCCAGATGGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 0, 3: 16, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!