ID: 1203165181_1203165187 |
View in Genome Browser |
Spacer: 23 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1203165181 | 1203165187 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 17_GL000205v2_random:87193-87215 | 17_GL000205v2_random:87239-87261 |
Sequence | CCAGGAAGCAGAAGGAGGGGTCC | AATGCGCACTGTCCCTGAGCTGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 0, 2: 0, 3: 40, 4: 311} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |