ID: 1203165183_1203165188

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1203165183 1203165188
Species Human (GRCh38) Human (GRCh38)
Location 17_GL000205v2_random:87220-87242 17_GL000205v2_random:87240-87262
Sequence CCTAGCCTTTTCCTCCAGTAATG ATGCGCACTGTCCCTGAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!