ID: 1203180360_1203180362

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1203180360 1203180362
Species Human (GRCh38) Human (GRCh38)
Location 17_KI270729v1_random:51830-51852 17_KI270729v1_random:51849-51871
Sequence CCAAATGGAATGGACAGAATGGA TGGATTGGAATACAATAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 269, 3: 3983, 4: 27589}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!