ID: 1203192471_1203192473

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1203192471 1203192473
Species Human (GRCh38) Human (GRCh38)
Location 17_KI270729v1_random:202141-202163 17_KI270729v1_random:202171-202193
Sequence CCCACTGGGGCTATTAAGGTAGT TATTATCTTTAGAAGTTTTATGG
Strand - +
Off-target summary {0: 7, 1: 4, 2: 2, 3: 8, 4: 70} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!