ID: 1203216901_1203216905 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203216901 | 1203216905 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 22_KI270731v1_random:11337-11359 | 22_KI270731v1_random:11362-11384 |
| Sequence | CCTCTGGGCACCTGCTGCAGCTG | GCTGAGGCCCAGAAATGTGAAGG |
| Strand | - | + |
| Off-target summary | No data | {0: 14, 1: 25, 2: 11, 3: 102, 4: 614} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||