ID: 1203234576_1203234582

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1203234576 1203234582
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270731v1_random:142678-142700 22_KI270731v1_random:142691-142713
Sequence CCCTGCTGCCAAAGACACTGGGG GACACTGGGGGGTTTCTTCCTGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 2, 3: 8, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!