ID: 1203255388_1203255393

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1203255388 1203255393
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:135261-135283 22_KI270733v1_random:135290-135312
Sequence CCTCGACACAAGGGTTTGTCCGC GCGCGCGCGCGTGCGTGCGGGGG
Strand - +
Off-target summary No data {0: 3, 1: 3, 2: 8, 3: 71, 4: 335}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!