ID: 1203259655_1203259666

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1203259655 1203259666
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:166892-166914 22_KI270733v1_random:166913-166935
Sequence CCGTCCCCCGGGTGCCGGGGAGC GCGGTCCCCGGGCCGGGCCGCGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 8, 3: 58, 4: 479}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!