ID: 1203259955_1203259965

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1203259955 1203259965
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:167915-167937 22_KI270733v1_random:167932-167954
Sequence CCGCCCGCCGGCGGTGCGTGTGG GTGTGGGAAGGCGTGGGGTGCGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 9, 3: 115, 4: 1195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!