ID: 1203259970_1203259988

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1203259970 1203259988
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:167962-167984 22_KI270733v1_random:167994-168016
Sequence CCCGACCTCGCCGTCCCGCCCGC CGTCGCGGGGCGGGCCGGCGGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 53, 4: 570}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!