ID: 1203259972_1203259983

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203259972 1203259983
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:167967-167989 22_KI270733v1_random:167985-168007
Sequence CCTCGCCGTCCCGCCCGCCGCCT CGCCTTCTGCGTCGCGGGGCGGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 5, 3: 8, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!