ID: 1203259973_1203259986

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1203259973 1203259986
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:167972-167994 22_KI270733v1_random:167992-168014
Sequence CCGTCCCGCCCGCCGCCTTCTGC TGCGTCGCGGGGCGGGCCGGCGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 4, 3: 33, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!