ID: 1203261554_1203261560

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1203261554 1203261560
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:173676-173698 22_KI270733v1_random:173694-173716
Sequence CCTGCCGCGCGTGTGGCGTGCGC TGCGCCCCGCGCCGTGGGGGCGG
Strand - +
Off-target summary No data {0: 8, 1: 0, 2: 4, 3: 8, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!