ID: 1203262786_1203262796

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203262786 1203262796
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270733v1_random:177852-177874 22_KI270733v1_random:177879-177901
Sequence CCAGTGCGGTAACGCGACCGATC AGAAGCCGGCGGGAGCCCCGGGG
Strand - +
Off-target summary No data {0: 9, 1: 0, 2: 4, 3: 18, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!