ID: 1203266541_1203266549

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1203266541 1203266549
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270734v1_random:18225-18247 22_KI270734v1_random:18261-18283
Sequence CCCTTGGGAAGTCTCATGGCTAC AGGTGTGACAACAGGGAAGAGGG
Strand - +
Off-target summary {0: 4, 1: 3, 2: 0, 3: 4, 4: 109} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!