ID: 1203271868_1203271874

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1203271868 1203271874
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270734v1_random:59472-59494 22_KI270734v1_random:59499-59521
Sequence CCCTTGGAAATCGGCGCGTGGGG GTGCTCGAGCTGAGCGCGAGAGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 0, 3: 4, 4: 27} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!