ID: 1203289119_1203289128

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1203289119 1203289128
Species Human (GRCh38) Human (GRCh38)
Location 22_KI270735v1_random:17259-17281 22_KI270735v1_random:17293-17315
Sequence CCATCGCCGCCACGTGCAAGGCC GACTCAGCGGCCCAGGCAGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 42, 4: 927}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!