ID: 1203296354_1203296358 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1203296354 | 1203296358 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 22_KI270736v1_random:46395-46417 | 22_KI270736v1_random:46411-46433 |
| Sequence | CCAGAGACCAGGTGTGAGGAGCA | AGGAGCAAAGTGGGTACAGATGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 1, 2: 1, 3: 27, 4: 243} | {0: 2, 1: 0, 2: 1, 3: 25, 4: 324} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||